ID: 1156519321

View in Genome Browser
Species Human (GRCh38)
Location 18:37708305-37708327
Sequence TTGGCCTCACACACTGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156519314_1156519321 13 Left 1156519314 18:37708269-37708291 CCTTGGTTCTCTCTCTCCTCTTC No data
Right 1156519321 18:37708305-37708327 TTGGCCTCACACACTGAGCAGGG No data
1156519315_1156519321 -3 Left 1156519315 18:37708285-37708307 CCTCTTCTCCCTGCTTCCTTTTG No data
Right 1156519321 18:37708305-37708327 TTGGCCTCACACACTGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156519321 Original CRISPR TTGGCCTCACACACTGAGCA GGG Intergenic
No off target data available for this crispr