ID: 1156519325

View in Genome Browser
Species Human (GRCh38)
Location 18:37708330-37708352
Sequence AGGTTTTATTCTAGTAAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156519317_1156519325 14 Left 1156519317 18:37708293-37708315 CCCTGCTTCCTTTTGGCCTCACA No data
Right 1156519325 18:37708330-37708352 AGGTTTTATTCTAGTAAACTTGG No data
1156519322_1156519325 -2 Left 1156519322 18:37708309-37708331 CCTCACACACTGAGCAGGGCCAG No data
Right 1156519325 18:37708330-37708352 AGGTTTTATTCTAGTAAACTTGG No data
1156519319_1156519325 6 Left 1156519319 18:37708301-37708323 CCTTTTGGCCTCACACACTGAGC No data
Right 1156519325 18:37708330-37708352 AGGTTTTATTCTAGTAAACTTGG No data
1156519315_1156519325 22 Left 1156519315 18:37708285-37708307 CCTCTTCTCCCTGCTTCCTTTTG No data
Right 1156519325 18:37708330-37708352 AGGTTTTATTCTAGTAAACTTGG No data
1156519318_1156519325 13 Left 1156519318 18:37708294-37708316 CCTGCTTCCTTTTGGCCTCACAC No data
Right 1156519325 18:37708330-37708352 AGGTTTTATTCTAGTAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156519325 Original CRISPR AGGTTTTATTCTAGTAAACT TGG Intergenic
No off target data available for this crispr