ID: 1156519326

View in Genome Browser
Species Human (GRCh38)
Location 18:37708331-37708353
Sequence GGTTTTATTCTAGTAAACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156519317_1156519326 15 Left 1156519317 18:37708293-37708315 CCCTGCTTCCTTTTGGCCTCACA No data
Right 1156519326 18:37708331-37708353 GGTTTTATTCTAGTAAACTTGGG No data
1156519315_1156519326 23 Left 1156519315 18:37708285-37708307 CCTCTTCTCCCTGCTTCCTTTTG No data
Right 1156519326 18:37708331-37708353 GGTTTTATTCTAGTAAACTTGGG No data
1156519322_1156519326 -1 Left 1156519322 18:37708309-37708331 CCTCACACACTGAGCAGGGCCAG No data
Right 1156519326 18:37708331-37708353 GGTTTTATTCTAGTAAACTTGGG No data
1156519318_1156519326 14 Left 1156519318 18:37708294-37708316 CCTGCTTCCTTTTGGCCTCACAC No data
Right 1156519326 18:37708331-37708353 GGTTTTATTCTAGTAAACTTGGG No data
1156519319_1156519326 7 Left 1156519319 18:37708301-37708323 CCTTTTGGCCTCACACACTGAGC No data
Right 1156519326 18:37708331-37708353 GGTTTTATTCTAGTAAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156519326 Original CRISPR GGTTTTATTCTAGTAAACTT GGG Intergenic
No off target data available for this crispr