ID: 1156519357

View in Genome Browser
Species Human (GRCh38)
Location 18:37708727-37708749
Sequence ATAGAGAAGTGGAGAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156519357_1156519364 6 Left 1156519357 18:37708727-37708749 CCTTCCTCTCTCCACTTCTCTAT No data
Right 1156519364 18:37708756-37708778 CCACACGATTTTTCTACTCAGGG No data
1156519357_1156519362 5 Left 1156519357 18:37708727-37708749 CCTTCCTCTCTCCACTTCTCTAT No data
Right 1156519362 18:37708755-37708777 CCCACACGATTTTTCTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156519357 Original CRISPR ATAGAGAAGTGGAGAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr