ID: 1156524955

View in Genome Browser
Species Human (GRCh38)
Location 18:37758252-37758274
Sequence CCATGATCGTAAGCTTCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156524955_1156524959 -9 Left 1156524955 18:37758252-37758274 CCTTAAGAAGCTTACGATCATGG No data
Right 1156524959 18:37758266-37758288 CGATCATGGCTGAAGGCAAAGGG No data
1156524955_1156524958 -10 Left 1156524955 18:37758252-37758274 CCTTAAGAAGCTTACGATCATGG No data
Right 1156524958 18:37758265-37758287 ACGATCATGGCTGAAGGCAAAGG No data
1156524955_1156524966 14 Left 1156524955 18:37758252-37758274 CCTTAAGAAGCTTACGATCATGG No data
Right 1156524966 18:37758289-37758311 GGAGCAGGGGCATCATATGGTGG No data
1156524955_1156524964 1 Left 1156524955 18:37758252-37758274 CCTTAAGAAGCTTACGATCATGG No data
Right 1156524964 18:37758276-37758298 TGAAGGCAAAGGGGGAGCAGGGG No data
1156524955_1156524963 0 Left 1156524955 18:37758252-37758274 CCTTAAGAAGCTTACGATCATGG No data
Right 1156524963 18:37758275-37758297 CTGAAGGCAAAGGGGGAGCAGGG No data
1156524955_1156524968 21 Left 1156524955 18:37758252-37758274 CCTTAAGAAGCTTACGATCATGG No data
Right 1156524968 18:37758296-37758318 GGGCATCATATGGTGGGTGCAGG No data
1156524955_1156524962 -1 Left 1156524955 18:37758252-37758274 CCTTAAGAAGCTTACGATCATGG No data
Right 1156524962 18:37758274-37758296 GCTGAAGGCAAAGGGGGAGCAGG No data
1156524955_1156524961 -7 Left 1156524955 18:37758252-37758274 CCTTAAGAAGCTTACGATCATGG No data
Right 1156524961 18:37758268-37758290 ATCATGGCTGAAGGCAAAGGGGG 0: 18
1: 547
2: 1431
3: 2380
4: 3351
1156524955_1156524960 -8 Left 1156524955 18:37758252-37758274 CCTTAAGAAGCTTACGATCATGG No data
Right 1156524960 18:37758267-37758289 GATCATGGCTGAAGGCAAAGGGG No data
1156524955_1156524965 11 Left 1156524955 18:37758252-37758274 CCTTAAGAAGCTTACGATCATGG No data
Right 1156524965 18:37758286-37758308 GGGGGAGCAGGGGCATCATATGG No data
1156524955_1156524967 15 Left 1156524955 18:37758252-37758274 CCTTAAGAAGCTTACGATCATGG No data
Right 1156524967 18:37758290-37758312 GAGCAGGGGCATCATATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156524955 Original CRISPR CCATGATCGTAAGCTTCTTA AGG (reversed) Intergenic
No off target data available for this crispr