ID: 1156524963

View in Genome Browser
Species Human (GRCh38)
Location 18:37758275-37758297
Sequence CTGAAGGCAAAGGGGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156524955_1156524963 0 Left 1156524955 18:37758252-37758274 CCTTAAGAAGCTTACGATCATGG No data
Right 1156524963 18:37758275-37758297 CTGAAGGCAAAGGGGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156524963 Original CRISPR CTGAAGGCAAAGGGGGAGCA GGG Intergenic
No off target data available for this crispr