ID: 1156525867

View in Genome Browser
Species Human (GRCh38)
Location 18:37766674-37766696
Sequence GATGAGCTGACTGGAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156525867_1156525871 -6 Left 1156525867 18:37766674-37766696 CCAGCAGCTCCAGTCAGCTCATC No data
Right 1156525871 18:37766691-37766713 CTCATCCTCTGGAATCTAGGTGG No data
1156525867_1156525878 30 Left 1156525867 18:37766674-37766696 CCAGCAGCTCCAGTCAGCTCATC No data
Right 1156525878 18:37766727-37766749 CCCAAAGCTTTGCTGGATACAGG No data
1156525867_1156525875 23 Left 1156525867 18:37766674-37766696 CCAGCAGCTCCAGTCAGCTCATC No data
Right 1156525875 18:37766720-37766742 CCACATCCCCAAAGCTTTGCTGG No data
1156525867_1156525872 -3 Left 1156525867 18:37766674-37766696 CCAGCAGCTCCAGTCAGCTCATC No data
Right 1156525872 18:37766694-37766716 ATCCTCTGGAATCTAGGTGGAGG No data
1156525867_1156525870 -9 Left 1156525867 18:37766674-37766696 CCAGCAGCTCCAGTCAGCTCATC No data
Right 1156525870 18:37766688-37766710 CAGCTCATCCTCTGGAATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156525867 Original CRISPR GATGAGCTGACTGGAGCTGC TGG (reversed) Intergenic