ID: 1156537386

View in Genome Browser
Species Human (GRCh38)
Location 18:37877412-37877434
Sequence CCTTGGCATGAACTGTTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156537378_1156537386 28 Left 1156537378 18:37877361-37877383 CCCCAAAATGCTAAGGACTCCAC No data
Right 1156537386 18:37877412-37877434 CCTTGGCATGAACTGTTTAGAGG No data
1156537379_1156537386 27 Left 1156537379 18:37877362-37877384 CCCAAAATGCTAAGGACTCCACT 0: 3
1: 155
2: 141
3: 100
4: 170
Right 1156537386 18:37877412-37877434 CCTTGGCATGAACTGTTTAGAGG No data
1156537380_1156537386 26 Left 1156537380 18:37877363-37877385 CCAAAATGCTAAGGACTCCACTT 0: 3
1: 88
2: 89
3: 51
4: 162
Right 1156537386 18:37877412-37877434 CCTTGGCATGAACTGTTTAGAGG No data
1156537382_1156537386 9 Left 1156537382 18:37877380-37877402 CCACTTCTAATAGTATGGAGAAC 0: 4
1: 2
2: 0
3: 8
4: 85
Right 1156537386 18:37877412-37877434 CCTTGGCATGAACTGTTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156537386 Original CRISPR CCTTGGCATGAACTGTTTAG AGG Intergenic
No off target data available for this crispr