ID: 1156538637

View in Genome Browser
Species Human (GRCh38)
Location 18:37888165-37888187
Sequence CTGGCTCTGGACTGCTTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156538634_1156538637 -10 Left 1156538634 18:37888152-37888174 CCTTGCTGAAATCCTGGCTCTGG No data
Right 1156538637 18:37888165-37888187 CTGGCTCTGGACTGCTTAGCAGG No data
1156538631_1156538637 28 Left 1156538631 18:37888114-37888136 CCTGGGCAGCGGTGGGAGATGGA No data
Right 1156538637 18:37888165-37888187 CTGGCTCTGGACTGCTTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156538637 Original CRISPR CTGGCTCTGGACTGCTTAGC AGG Intergenic
No off target data available for this crispr