ID: 1156541764

View in Genome Browser
Species Human (GRCh38)
Location 18:37919026-37919048
Sequence CTACATCACTAGTTCTCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156541764_1156541766 15 Left 1156541764 18:37919026-37919048 CCCATTGAGAACTAGTGATGTAG No data
Right 1156541766 18:37919064-37919086 AAAGTACTTTCATGTCACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156541764 Original CRISPR CTACATCACTAGTTCTCAAT GGG (reversed) Intergenic
No off target data available for this crispr