ID: 1156545806

View in Genome Browser
Species Human (GRCh38)
Location 18:37962621-37962643
Sequence GTCCGGGTGGAGCACCGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156545806_1156545811 -5 Left 1156545806 18:37962621-37962643 CCTACACGGTGCTCCACCCGGAC No data
Right 1156545811 18:37962639-37962661 CGGACTCTCAGCCTGGATACTGG No data
1156545806_1156545814 12 Left 1156545806 18:37962621-37962643 CCTACACGGTGCTCCACCCGGAC No data
Right 1156545814 18:37962656-37962678 TACTGGGCAGCATGCTGATAAGG No data
1156545806_1156545815 20 Left 1156545806 18:37962621-37962643 CCTACACGGTGCTCCACCCGGAC No data
Right 1156545815 18:37962664-37962686 AGCATGCTGATAAGGAGCCAAGG No data
1156545806_1156545812 -4 Left 1156545806 18:37962621-37962643 CCTACACGGTGCTCCACCCGGAC No data
Right 1156545812 18:37962640-37962662 GGACTCTCAGCCTGGATACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156545806 Original CRISPR GTCCGGGTGGAGCACCGTGT AGG (reversed) Intergenic
No off target data available for this crispr