ID: 1156550477

View in Genome Browser
Species Human (GRCh38)
Location 18:38011143-38011165
Sequence CAAAGAAGACAGAAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156550473_1156550477 10 Left 1156550473 18:38011110-38011132 CCTGAAATTCAGTGAGCTAAACT No data
Right 1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156550477 Original CRISPR CAAAGAAGACAGAAGGAGGG AGG Intergenic
No off target data available for this crispr