ID: 1156565090

View in Genome Browser
Species Human (GRCh38)
Location 18:38178993-38179015
Sequence TTAAGATACCACTTGATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156565088_1156565090 10 Left 1156565088 18:38178960-38178982 CCAACACTTGAGTTGCTTTTTTT No data
Right 1156565090 18:38178993-38179015 TTAAGATACCACTTGATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156565090 Original CRISPR TTAAGATACCACTTGATGAA TGG Intergenic
No off target data available for this crispr