ID: 1156565180

View in Genome Browser
Species Human (GRCh38)
Location 18:38180191-38180213
Sequence TAGAAAAAGCATAATTAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156565180_1156565182 17 Left 1156565180 18:38180191-38180213 CCGGCCTAATTATGCTTTTTCTA No data
Right 1156565182 18:38180231-38180253 TATAGAAATACAACAAACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156565180 Original CRISPR TAGAAAAAGCATAATTAGGC CGG (reversed) Intergenic
No off target data available for this crispr