ID: 1156567111

View in Genome Browser
Species Human (GRCh38)
Location 18:38204307-38204329
Sequence AACCTTCATATGCTACTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156567111_1156567114 27 Left 1156567111 18:38204307-38204329 CCAATCAGTAGCATATGAAGGTT No data
Right 1156567114 18:38204357-38204379 TGTTCTTACTCTTTTGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156567111 Original CRISPR AACCTTCATATGCTACTGAT TGG (reversed) Intergenic
No off target data available for this crispr