ID: 1156567259

View in Genome Browser
Species Human (GRCh38)
Location 18:38206259-38206281
Sequence TACAATACTCAACCTGATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156567259_1156567260 -2 Left 1156567259 18:38206259-38206281 CCATAATCAGGTTGAGTATTGTA No data
Right 1156567260 18:38206280-38206302 TAACATATACCACTCAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156567259 Original CRISPR TACAATACTCAACCTGATTA TGG (reversed) Intergenic
No off target data available for this crispr