ID: 1156571761

View in Genome Browser
Species Human (GRCh38)
Location 18:38263694-38263716
Sequence CCTCATGGTAATCATCTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156571758_1156571761 -2 Left 1156571758 18:38263673-38263695 CCACTCAGTCTTGTTATTTGGCC No data
Right 1156571761 18:38263694-38263716 CCTCATGGTAATCATCTTTGAGG No data
1156571756_1156571761 2 Left 1156571756 18:38263669-38263691 CCTTCCACTCAGTCTTGTTATTT No data
Right 1156571761 18:38263694-38263716 CCTCATGGTAATCATCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156571761 Original CRISPR CCTCATGGTAATCATCTTTG AGG Intergenic
No off target data available for this crispr