ID: 1156571845

View in Genome Browser
Species Human (GRCh38)
Location 18:38264496-38264518
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156571845_1156571848 9 Left 1156571845 18:38264496-38264518 CCAATAGGAGTGGCCTTGGAGGG No data
Right 1156571848 18:38264528-38264550 AGAAAGAATATTTCAGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156571845 Original CRISPR CCCTCCAAGGCCACTCCTAT TGG (reversed) Intergenic
No off target data available for this crispr