ID: 1156575410

View in Genome Browser
Species Human (GRCh38)
Location 18:38309408-38309430
Sequence GACTGAATACCTTCAGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156575410_1156575416 20 Left 1156575410 18:38309408-38309430 CCAGATTCTGAAGGTATTCAGTC No data
Right 1156575416 18:38309451-38309473 CTTTATCTTGTACAATTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156575410 Original CRISPR GACTGAATACCTTCAGAATC TGG (reversed) Intergenic
No off target data available for this crispr