ID: 1156576950

View in Genome Browser
Species Human (GRCh38)
Location 18:38328165-38328187
Sequence CCTTAGATGGGGAAAAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156576942_1156576950 -4 Left 1156576942 18:38328146-38328168 CCAATGTAATGAAAAAGGCCCTT No data
Right 1156576950 18:38328165-38328187 CCTTAGATGGGGAAAAGGGAAGG No data
1156576938_1156576950 7 Left 1156576938 18:38328135-38328157 CCCATGCGGACCCAATGTAATGA No data
Right 1156576950 18:38328165-38328187 CCTTAGATGGGGAAAAGGGAAGG No data
1156576941_1156576950 -3 Left 1156576941 18:38328145-38328167 CCCAATGTAATGAAAAAGGCCCT No data
Right 1156576950 18:38328165-38328187 CCTTAGATGGGGAAAAGGGAAGG No data
1156576939_1156576950 6 Left 1156576939 18:38328136-38328158 CCATGCGGACCCAATGTAATGAA No data
Right 1156576950 18:38328165-38328187 CCTTAGATGGGGAAAAGGGAAGG No data
1156576937_1156576950 16 Left 1156576937 18:38328126-38328148 CCTAGATTACCCATGCGGACCCA No data
Right 1156576950 18:38328165-38328187 CCTTAGATGGGGAAAAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156576950 Original CRISPR CCTTAGATGGGGAAAAGGGA AGG Intergenic
No off target data available for this crispr