ID: 1156578027

View in Genome Browser
Species Human (GRCh38)
Location 18:38342052-38342074
Sequence GGGTTAATGGTAGCATGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156578025_1156578027 -9 Left 1156578025 18:38342038-38342060 CCAAGATGGGAGATGGGTTAATG No data
Right 1156578027 18:38342052-38342074 GGGTTAATGGTAGCATGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156578027 Original CRISPR GGGTTAATGGTAGCATGCTC TGG Intergenic
No off target data available for this crispr