ID: 1156578310

View in Genome Browser
Species Human (GRCh38)
Location 18:38345862-38345884
Sequence ATTGATGCTGGTATTGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156578310_1156578314 -5 Left 1156578310 18:38345862-38345884 CCAGGCCCAATACCAGCATCAAT No data
Right 1156578314 18:38345880-38345902 TCAATCAAGATGCTCATGAATGG No data
1156578310_1156578315 -2 Left 1156578310 18:38345862-38345884 CCAGGCCCAATACCAGCATCAAT No data
Right 1156578315 18:38345883-38345905 ATCAAGATGCTCATGAATGGTGG No data
1156578310_1156578317 18 Left 1156578310 18:38345862-38345884 CCAGGCCCAATACCAGCATCAAT No data
Right 1156578317 18:38345903-38345925 TGGACTGGATAAAGAAAATGTGG No data
1156578310_1156578316 3 Left 1156578310 18:38345862-38345884 CCAGGCCCAATACCAGCATCAAT No data
Right 1156578316 18:38345888-38345910 GATGCTCATGAATGGTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156578310 Original CRISPR ATTGATGCTGGTATTGGGCC TGG (reversed) Intergenic