ID: 1156579632

View in Genome Browser
Species Human (GRCh38)
Location 18:38359858-38359880
Sequence AGGCTGTGTCAGATGGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156579632_1156579638 0 Left 1156579632 18:38359858-38359880 CCTTACTCCATCTGACACAGCCT No data
Right 1156579638 18:38359881-38359903 CCCTAGGGCTCTCTAAGACCTGG No data
1156579632_1156579640 1 Left 1156579632 18:38359858-38359880 CCTTACTCCATCTGACACAGCCT No data
Right 1156579640 18:38359882-38359904 CCTAGGGCTCTCTAAGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156579632 Original CRISPR AGGCTGTGTCAGATGGAGTA AGG (reversed) Intergenic
No off target data available for this crispr