ID: 1156579723

View in Genome Browser
Species Human (GRCh38)
Location 18:38361039-38361061
Sequence CAGCTACAGTTGGCCGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156579723_1156579725 10 Left 1156579723 18:38361039-38361061 CCAAACTCGGCCAACTGTAGCTG No data
Right 1156579725 18:38361072-38361094 TGCAAGTTATTATTCACTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156579723 Original CRISPR CAGCTACAGTTGGCCGAGTT TGG (reversed) Intergenic
No off target data available for this crispr