ID: 1156586459

View in Genome Browser
Species Human (GRCh38)
Location 18:38436506-38436528
Sequence AAACCAACTGTAGCATGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156586450_1156586459 29 Left 1156586450 18:38436454-38436476 CCGTCAGATCTGCCTTTGCTTTA No data
Right 1156586459 18:38436506-38436528 AAACCAACTGTAGCATGATTTGG No data
1156586453_1156586459 17 Left 1156586453 18:38436466-38436488 CCTTTGCTTTAGGGTCACTTTAG No data
Right 1156586459 18:38436506-38436528 AAACCAACTGTAGCATGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156586459 Original CRISPR AAACCAACTGTAGCATGATT TGG Intergenic
No off target data available for this crispr