ID: 1156588625

View in Genome Browser
Species Human (GRCh38)
Location 18:38460780-38460802
Sequence CTGGGTCAAGCGTCGCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156588621_1156588625 6 Left 1156588621 18:38460751-38460773 CCAGGGAAATTTTTAAATTACTG No data
Right 1156588625 18:38460780-38460802 CTGGGTCAAGCGTCGCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156588625 Original CRISPR CTGGGTCAAGCGTCGCATGT TGG Intergenic
No off target data available for this crispr