ID: 1156588680

View in Genome Browser
Species Human (GRCh38)
Location 18:38461373-38461395
Sequence AACATTGGCCTCTTATTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156588680_1156588684 18 Left 1156588680 18:38461373-38461395 CCAATCAATAAGAGGCCAATGTT No data
Right 1156588684 18:38461414-38461436 CACTAGGAAAGAGGTCCCAAAGG No data
1156588680_1156588685 19 Left 1156588680 18:38461373-38461395 CCAATCAATAAGAGGCCAATGTT No data
Right 1156588685 18:38461415-38461437 ACTAGGAAAGAGGTCCCAAAGGG No data
1156588680_1156588682 2 Left 1156588680 18:38461373-38461395 CCAATCAATAAGAGGCCAATGTT No data
Right 1156588682 18:38461398-38461420 AGAAGAACAATCAGAACACTAGG No data
1156588680_1156588683 9 Left 1156588680 18:38461373-38461395 CCAATCAATAAGAGGCCAATGTT No data
Right 1156588683 18:38461405-38461427 CAATCAGAACACTAGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156588680 Original CRISPR AACATTGGCCTCTTATTGAT TGG (reversed) Intergenic
No off target data available for this crispr