ID: 1156602613

View in Genome Browser
Species Human (GRCh38)
Location 18:38627308-38627330
Sequence AGATATCTGCAGAAAAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156602613_1156602619 12 Left 1156602613 18:38627308-38627330 CCTGACCTTTTCTGCAGATATCT No data
Right 1156602619 18:38627343-38627365 GGGGCTAAAGCTGAAGACACAGG No data
1156602613_1156602617 -8 Left 1156602613 18:38627308-38627330 CCTGACCTTTTCTGCAGATATCT No data
Right 1156602617 18:38627323-38627345 AGATATCTCTTATTGATTTGGGG No data
1156602613_1156602620 25 Left 1156602613 18:38627308-38627330 CCTGACCTTTTCTGCAGATATCT No data
Right 1156602620 18:38627356-38627378 AAGACACAGGAGCTGCCTACTGG No data
1156602613_1156602616 -9 Left 1156602613 18:38627308-38627330 CCTGACCTTTTCTGCAGATATCT No data
Right 1156602616 18:38627322-38627344 CAGATATCTCTTATTGATTTGGG No data
1156602613_1156602615 -10 Left 1156602613 18:38627308-38627330 CCTGACCTTTTCTGCAGATATCT No data
Right 1156602615 18:38627321-38627343 GCAGATATCTCTTATTGATTTGG No data
1156602613_1156602621 26 Left 1156602613 18:38627308-38627330 CCTGACCTTTTCTGCAGATATCT No data
Right 1156602621 18:38627357-38627379 AGACACAGGAGCTGCCTACTGGG No data
1156602613_1156602618 -7 Left 1156602613 18:38627308-38627330 CCTGACCTTTTCTGCAGATATCT No data
Right 1156602618 18:38627324-38627346 GATATCTCTTATTGATTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156602613 Original CRISPR AGATATCTGCAGAAAAGGTC AGG (reversed) Intergenic
No off target data available for this crispr