ID: 1156606368

View in Genome Browser
Species Human (GRCh38)
Location 18:38671734-38671756
Sequence AGTTATCTTCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156606368_1156606370 4 Left 1156606368 18:38671734-38671756 CCTGCCATCTTCTGAAGATAACT No data
Right 1156606370 18:38671761-38671783 TCCTTTTGAGAGACATTTCTTGG No data
1156606368_1156606372 15 Left 1156606368 18:38671734-38671756 CCTGCCATCTTCTGAAGATAACT No data
Right 1156606372 18:38671772-38671794 GACATTTCTTGGCCTGTGATTGG No data
1156606368_1156606373 16 Left 1156606368 18:38671734-38671756 CCTGCCATCTTCTGAAGATAACT No data
Right 1156606373 18:38671773-38671795 ACATTTCTTGGCCTGTGATTGGG No data
1156606368_1156606375 25 Left 1156606368 18:38671734-38671756 CCTGCCATCTTCTGAAGATAACT No data
Right 1156606375 18:38671782-38671804 GGCCTGTGATTGGGCTTTGGTGG No data
1156606368_1156606374 22 Left 1156606368 18:38671734-38671756 CCTGCCATCTTCTGAAGATAACT No data
Right 1156606374 18:38671779-38671801 CTTGGCCTGTGATTGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156606368 Original CRISPR AGTTATCTTCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr