ID: 1156606372

View in Genome Browser
Species Human (GRCh38)
Location 18:38671772-38671794
Sequence GACATTTCTTGGCCTGTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156606368_1156606372 15 Left 1156606368 18:38671734-38671756 CCTGCCATCTTCTGAAGATAACT No data
Right 1156606372 18:38671772-38671794 GACATTTCTTGGCCTGTGATTGG No data
1156606367_1156606372 16 Left 1156606367 18:38671733-38671755 CCCTGCCATCTTCTGAAGATAAC No data
Right 1156606372 18:38671772-38671794 GACATTTCTTGGCCTGTGATTGG No data
1156606369_1156606372 11 Left 1156606369 18:38671738-38671760 CCATCTTCTGAAGATAACTACTC No data
Right 1156606372 18:38671772-38671794 GACATTTCTTGGCCTGTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156606372 Original CRISPR GACATTTCTTGGCCTGTGAT TGG Intergenic
No off target data available for this crispr