ID: 1156610014

View in Genome Browser
Species Human (GRCh38)
Location 18:38714766-38714788
Sequence CTGCGTATGTGGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156610008_1156610014 -1 Left 1156610008 18:38714744-38714766 CCTAGTCTCCTTGTGGAACCAAC No data
Right 1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG No data
1156610004_1156610014 17 Left 1156610004 18:38714726-38714748 CCTTCCATGATTGTGAGCCCTAG No data
Right 1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG No data
1156610005_1156610014 13 Left 1156610005 18:38714730-38714752 CCATGATTGTGAGCCCTAGTCTC No data
Right 1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG No data
1156610007_1156610014 0 Left 1156610007 18:38714743-38714765 CCCTAGTCTCCTTGTGGAACCAA No data
Right 1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG No data
1156610009_1156610014 -9 Left 1156610009 18:38714752-38714774 CCTTGTGGAACCAACTGCGTATG No data
Right 1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156610014 Original CRISPR CTGCGTATGTGGAGGGAAGC TGG Intergenic
No off target data available for this crispr