ID: 1156612889

View in Genome Browser
Species Human (GRCh38)
Location 18:38748445-38748467
Sequence CTGTAAGGACAGAATAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156612889_1156612894 16 Left 1156612889 18:38748445-38748467 CCCAGCTTATTCTGTCCTTACAG No data
Right 1156612894 18:38748484-38748506 AGAATGATATTATTTGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156612889 Original CRISPR CTGTAAGGACAGAATAAGCT GGG (reversed) Intergenic
No off target data available for this crispr