ID: 1156616997

View in Genome Browser
Species Human (GRCh38)
Location 18:38799177-38799199
Sequence CAGAGAGCCCCCCGACCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156616995_1156616997 6 Left 1156616995 18:38799148-38799170 CCTTAGGTAGACAGAAAGAAAAA No data
Right 1156616997 18:38799177-38799199 CAGAGAGCCCCCCGACCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156616997 Original CRISPR CAGAGAGCCCCCCGACCCAC AGG Intergenic
No off target data available for this crispr