ID: 1156617104

View in Genome Browser
Species Human (GRCh38)
Location 18:38799923-38799945
Sequence CAAAGAGGCAGTTGCTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156617104_1156617107 20 Left 1156617104 18:38799923-38799945 CCTTCAGAGCAACTGCCTCTTTG No data
Right 1156617107 18:38799966-38799988 CTCCATTGCCAGATCTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156617104 Original CRISPR CAAAGAGGCAGTTGCTCTGA AGG (reversed) Intergenic
No off target data available for this crispr