ID: 1156617401

View in Genome Browser
Species Human (GRCh38)
Location 18:38803663-38803685
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156617399_1156617401 22 Left 1156617399 18:38803618-38803640 CCAGAGAGTGGGGAAAAGGTGAA No data
Right 1156617401 18:38803663-38803685 TATGATCACCACAGCCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156617401 Original CRISPR TATGATCACCACAGCCATCT GGG Intergenic
No off target data available for this crispr