ID: 1156617474

View in Genome Browser
Species Human (GRCh38)
Location 18:38804503-38804525
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156617474_1156617482 24 Left 1156617474 18:38804503-38804525 CCCATTATAAATTCTTTCTACCT No data
Right 1156617482 18:38804550-38804572 CTTTTCGAGTCAATAATTATGGG No data
1156617474_1156617477 -7 Left 1156617474 18:38804503-38804525 CCCATTATAAATTCTTTCTACCT No data
Right 1156617477 18:38804519-38804541 TCTACCTAATGTAAACCAGAGGG No data
1156617474_1156617481 23 Left 1156617474 18:38804503-38804525 CCCATTATAAATTCTTTCTACCT No data
Right 1156617481 18:38804549-38804571 GCTTTTCGAGTCAATAATTATGG No data
1156617474_1156617476 -8 Left 1156617474 18:38804503-38804525 CCCATTATAAATTCTTTCTACCT No data
Right 1156617476 18:38804518-38804540 TTCTACCTAATGTAAACCAGAGG No data
1156617474_1156617478 -6 Left 1156617474 18:38804503-38804525 CCCATTATAAATTCTTTCTACCT No data
Right 1156617478 18:38804520-38804542 CTACCTAATGTAAACCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156617474 Original CRISPR AGGTAGAAAGAATTTATAAT GGG (reversed) Intergenic
No off target data available for this crispr