ID: 1156617479

View in Genome Browser
Species Human (GRCh38)
Location 18:38804523-38804545
Sequence AGTCCCCTCTGGTTTACATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156617479_1156617482 4 Left 1156617479 18:38804523-38804545 CCTAATGTAAACCAGAGGGGACT No data
Right 1156617482 18:38804550-38804572 CTTTTCGAGTCAATAATTATGGG No data
1156617479_1156617481 3 Left 1156617479 18:38804523-38804545 CCTAATGTAAACCAGAGGGGACT No data
Right 1156617481 18:38804549-38804571 GCTTTTCGAGTCAATAATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156617479 Original CRISPR AGTCCCCTCTGGTTTACATT AGG (reversed) Intergenic
No off target data available for this crispr