ID: 1156617480

View in Genome Browser
Species Human (GRCh38)
Location 18:38804534-38804556
Sequence CGAAAAGCAGAAGTCCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156617480_1156617482 -7 Left 1156617480 18:38804534-38804556 CCAGAGGGGACTTCTGCTTTTCG No data
Right 1156617482 18:38804550-38804572 CTTTTCGAGTCAATAATTATGGG No data
1156617480_1156617481 -8 Left 1156617480 18:38804534-38804556 CCAGAGGGGACTTCTGCTTTTCG No data
Right 1156617481 18:38804549-38804571 GCTTTTCGAGTCAATAATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156617480 Original CRISPR CGAAAAGCAGAAGTCCCCTC TGG (reversed) Intergenic
No off target data available for this crispr