ID: 1156617482

View in Genome Browser
Species Human (GRCh38)
Location 18:38804550-38804572
Sequence CTTTTCGAGTCAATAATTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156617479_1156617482 4 Left 1156617479 18:38804523-38804545 CCTAATGTAAACCAGAGGGGACT No data
Right 1156617482 18:38804550-38804572 CTTTTCGAGTCAATAATTATGGG No data
1156617475_1156617482 23 Left 1156617475 18:38804504-38804526 CCATTATAAATTCTTTCTACCTA No data
Right 1156617482 18:38804550-38804572 CTTTTCGAGTCAATAATTATGGG No data
1156617480_1156617482 -7 Left 1156617480 18:38804534-38804556 CCAGAGGGGACTTCTGCTTTTCG No data
Right 1156617482 18:38804550-38804572 CTTTTCGAGTCAATAATTATGGG No data
1156617474_1156617482 24 Left 1156617474 18:38804503-38804525 CCCATTATAAATTCTTTCTACCT No data
Right 1156617482 18:38804550-38804572 CTTTTCGAGTCAATAATTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156617482 Original CRISPR CTTTTCGAGTCAATAATTAT GGG Intergenic
No off target data available for this crispr