ID: 1156619147

View in Genome Browser
Species Human (GRCh38)
Location 18:38828195-38828217
Sequence TTGAGTCAGTGGCATGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156619147_1156619153 19 Left 1156619147 18:38828195-38828217 CCTTCCCCATGCCACTGACTCAA No data
Right 1156619153 18:38828237-38828259 GCACCCTCACAGACACACCCAGG 0: 78
1: 1311
2: 1408
3: 1002
4: 1093
1156619147_1156619152 -6 Left 1156619147 18:38828195-38828217 CCTTCCCCATGCCACTGACTCAA No data
Right 1156619152 18:38828212-38828234 ACTCAAATGTTAATCTCTTTTGG 0: 333
1: 1828
2: 1542
3: 940
4: 960

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156619147 Original CRISPR TTGAGTCAGTGGCATGGGGA AGG (reversed) Intergenic
No off target data available for this crispr