ID: 1156624258

View in Genome Browser
Species Human (GRCh38)
Location 18:38889395-38889417
Sequence CAGTAGGAAGGGAAGTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156624258_1156624264 8 Left 1156624258 18:38889395-38889417 CCATCCAACTTCCCTTCCTACTG No data
Right 1156624264 18:38889426-38889448 ATAACTCCACCCTCTAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156624258 Original CRISPR CAGTAGGAAGGGAAGTTGGA TGG (reversed) Intergenic
No off target data available for this crispr