ID: 1156630526

View in Genome Browser
Species Human (GRCh38)
Location 18:38962933-38962955
Sequence GTACAACCCAGACACGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156630526_1156630530 3 Left 1156630526 18:38962933-38962955 CCTTTCCCGTGTCTGGGTTGTAC No data
Right 1156630530 18:38962959-38962981 CCAATTTCATGTCATCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156630526 Original CRISPR GTACAACCCAGACACGGGAA AGG (reversed) Intergenic
No off target data available for this crispr