ID: 1156634527

View in Genome Browser
Species Human (GRCh38)
Location 18:39011350-39011372
Sequence TCCCACTATCTCTGATGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156634527_1156634530 26 Left 1156634527 18:39011350-39011372 CCTGGGCATCAGAGATAGTGGGA No data
Right 1156634530 18:39011399-39011421 AGGACAGTGCAAGTCATAATTGG No data
1156634527_1156634528 6 Left 1156634527 18:39011350-39011372 CCTGGGCATCAGAGATAGTGGGA No data
Right 1156634528 18:39011379-39011401 GAACTCCTGAGAGACTGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156634527 Original CRISPR TCCCACTATCTCTGATGCCC AGG (reversed) Intergenic
No off target data available for this crispr