ID: 1156640183

View in Genome Browser
Species Human (GRCh38)
Location 18:39085670-39085692
Sequence GCGTGAGCCACCGCCTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156640176_1156640183 7 Left 1156640176 18:39085640-39085662 CCTCGGCCTCCGAAAGTGCCGGG No data
Right 1156640183 18:39085670-39085692 GCGTGAGCCACCGCCTTTGGTGG No data
1156640180_1156640183 -2 Left 1156640180 18:39085649-39085671 CCGAAAGTGCCGGGATTACAGGC 0: 1911
1: 221243
2: 273304
3: 186347
4: 142382
Right 1156640183 18:39085670-39085692 GCGTGAGCCACCGCCTTTGGTGG No data
1156640173_1156640183 11 Left 1156640173 18:39085636-39085658 CCCACCTCGGCCTCCGAAAGTGC 0: 255
1: 38749
2: 188656
3: 272034
4: 183837
Right 1156640183 18:39085670-39085692 GCGTGAGCCACCGCCTTTGGTGG No data
1156640170_1156640183 25 Left 1156640170 18:39085622-39085644 CCTCAGGTGATCCGCCCACCTCG 0: 2817
1: 19641
2: 54859
3: 89635
4: 99015
Right 1156640183 18:39085670-39085692 GCGTGAGCCACCGCCTTTGGTGG No data
1156640174_1156640183 10 Left 1156640174 18:39085637-39085659 CCACCTCGGCCTCCGAAAGTGCC No data
Right 1156640183 18:39085670-39085692 GCGTGAGCCACCGCCTTTGGTGG No data
1156640169_1156640183 30 Left 1156640169 18:39085617-39085639 CCTGACCTCAGGTGATCCGCCCA 0: 6256
1: 38634
2: 78388
3: 109169
4: 111926
Right 1156640183 18:39085670-39085692 GCGTGAGCCACCGCCTTTGGTGG No data
1156640172_1156640183 14 Left 1156640172 18:39085633-39085655 CCGCCCACCTCGGCCTCCGAAAG 0: 192
1: 28878
2: 115213
3: 161217
4: 173466
Right 1156640183 18:39085670-39085692 GCGTGAGCCACCGCCTTTGGTGG No data
1156640178_1156640183 1 Left 1156640178 18:39085646-39085668 CCTCCGAAAGTGCCGGGATTACA 0: 21
1: 4935
2: 308346
3: 271399
4: 149230
Right 1156640183 18:39085670-39085692 GCGTGAGCCACCGCCTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156640183 Original CRISPR GCGTGAGCCACCGCCTTTGG TGG Intergenic
No off target data available for this crispr