ID: 1156641212

View in Genome Browser
Species Human (GRCh38)
Location 18:39101615-39101637
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156641212_1156641219 0 Left 1156641212 18:39101615-39101637 CCTACCTGCACCAGAAGCTTCCT No data
Right 1156641219 18:39101638-39101660 TCGTGGGGCCCTTTGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156641212 Original CRISPR AGGAAGCTTCTGGTGCAGGT AGG (reversed) Intergenic
No off target data available for this crispr