ID: 1156641217

View in Genome Browser
Species Human (GRCh38)
Location 18:39101625-39101647
Sequence GGCCCCACGAAGGAAGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156641217_1156641219 -10 Left 1156641217 18:39101625-39101647 CCAGAAGCTTCCTTCGTGGGGCC No data
Right 1156641219 18:39101638-39101660 TCGTGGGGCCCTTTGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156641217 Original CRISPR GGCCCCACGAAGGAAGCTTC TGG (reversed) Intergenic
No off target data available for this crispr