ID: 1156641219

View in Genome Browser
Species Human (GRCh38)
Location 18:39101638-39101660
Sequence TCGTGGGGCCCTTTGTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156641212_1156641219 0 Left 1156641212 18:39101615-39101637 CCTACCTGCACCAGAAGCTTCCT No data
Right 1156641219 18:39101638-39101660 TCGTGGGGCCCTTTGTTTTATGG No data
1156641217_1156641219 -10 Left 1156641217 18:39101625-39101647 CCAGAAGCTTCCTTCGTGGGGCC No data
Right 1156641219 18:39101638-39101660 TCGTGGGGCCCTTTGTTTTATGG No data
1156641213_1156641219 -4 Left 1156641213 18:39101619-39101641 CCTGCACCAGAAGCTTCCTTCGT No data
Right 1156641219 18:39101638-39101660 TCGTGGGGCCCTTTGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156641219 Original CRISPR TCGTGGGGCCCTTTGTTTTA TGG Intergenic
No off target data available for this crispr