ID: 1156646428 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:39167206-39167228 |
| Sequence | TACCCAAGACTACCTGAGAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1156646428_1156646429 | 7 | Left | 1156646428 | 18:39167206-39167228 | CCTGTCTCAGGTAGTCTTGGGTA | No data | ||
| Right | 1156646429 | 18:39167236-39167258 | CTTATAGTTAGATTCATGATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1156646428 | Original CRISPR | TACCCAAGACTACCTGAGAC AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||