ID: 1156646428

View in Genome Browser
Species Human (GRCh38)
Location 18:39167206-39167228
Sequence TACCCAAGACTACCTGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156646428_1156646429 7 Left 1156646428 18:39167206-39167228 CCTGTCTCAGGTAGTCTTGGGTA No data
Right 1156646429 18:39167236-39167258 CTTATAGTTAGATTCATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156646428 Original CRISPR TACCCAAGACTACCTGAGAC AGG (reversed) Intergenic
No off target data available for this crispr