ID: 1156648533

View in Genome Browser
Species Human (GRCh38)
Location 18:39197154-39197176
Sequence CTATAAGCACAGATGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156648532_1156648533 -6 Left 1156648532 18:39197137-39197159 CCAGTGATGGGGAGTGGCTATAA No data
Right 1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156648533 Original CRISPR CTATAAGCACAGATGAAGCT TGG Intergenic
No off target data available for this crispr