ID: 1156649674

View in Genome Browser
Species Human (GRCh38)
Location 18:39210624-39210646
Sequence TGGTTAAGGACAACAATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156649674_1156649679 10 Left 1156649674 18:39210624-39210646 CCTTTAATTGTTGTCCTTAACCA No data
Right 1156649679 18:39210657-39210679 ATTTTCTTGGGTCATATAATTGG No data
1156649674_1156649677 -3 Left 1156649674 18:39210624-39210646 CCTTTAATTGTTGTCCTTAACCA No data
Right 1156649677 18:39210644-39210666 CCACAGATGCTTCATTTTCTTGG No data
1156649674_1156649678 -2 Left 1156649674 18:39210624-39210646 CCTTTAATTGTTGTCCTTAACCA No data
Right 1156649678 18:39210645-39210667 CACAGATGCTTCATTTTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156649674 Original CRISPR TGGTTAAGGACAACAATTAA AGG (reversed) Intergenic
No off target data available for this crispr